To order chemicals, medical devices, or other restricted products please provide ID that includes your business name & shipping address via email [email protected] or fax 484.881.5997 referencing your VWR account number. Acceptable forms of ID are:
- • State issued document with your organization's Federal Tax ID Number
- • State issued document with your organization's Resale Tax ID Number
- • City or County issued Business License
- • State Department of Health Services License
- • Any other ID issued by the State that includes the business name & address
* ATTN: California Customers may require additional documentation as part of the CA Health & Safety Code. Products that fall under this regulation will be placed on a mandatory 21-day hold after documentation is received. Avantor will not lift restrictions for residential shipping addresses.
Specifications
- Description:RVprimer3 (clockwise), 2microg
- Size:2 μg
- Storage Conditions:-30°C to -10°C
- Cat. No.:PAE4481
- Supplier no.:E4481
Specifications
About this item
The Reporter Vector (RV) Sequencing Primers are designed for sequencing inserts in the pGL3, pGL4, Chroma-Luc and pCAT3 Reporter Vectors.
- Designed for Use with the pGL4 Luciferase Vectors and Other Luciferase and CAT Reporter Vectors
- Sequence double-stranded templates using both primers
- Sequence single-stranded templates only using only RVprimer4
The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc Vectors and pCAT3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates. Primer Sequences: RVprimer3, 5'-d(CTAGCAAAATAGGCTGTCCC)-3'; RVprimer4, 5'-d(GACGATAGTCATGCCCCGCG)-3'.