Some Products May Appear Restricted
To ensure a smooth and speedy checkout, please log in to your account. Some items may show as restricted simply because you're not logged in.
If you do not have an account, you can register using our registration webform (https://www.avantorsciences.com/us/en/login/register)
If you're still seeing restrictions after logging in, certain products—like chemicals or medical devices—require additional account verification steps to be able to place an order. Some items may additionally require a specific license or customer documentation; additional documentation will be requested for these items prior to shipment.
Specifications
- Description:RVprimer3 (clockwise), 2microg
- Size:2 μg
- Storage Conditions:-30°C to -10°C
- Cat. No.:PAE4481
- Supplier no.:E4481
Specifications
About this item
The Reporter Vector (RV) Sequencing Primers are designed for sequencing inserts in the pGL3, pGL4, Chroma-Luc and pCAT3 Reporter Vectors.
- Designed for Use with the pGL4 Luciferase Vectors and Other Luciferase and CAT Reporter Vectors
- Sequence double-stranded templates using both primers
- Sequence single-stranded templates only using only RVprimer4
The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc Vectors and pCAT3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates. Primer Sequences: RVprimer3, 5'-d(CTAGCAAAATAGGCTGTCCC)-3'; RVprimer4, 5'-d(GACGATAGTCATGCCCCGCG)-3'.