To order chemicals, medical devices, or other restricted products please provide ID that includes your business name & shipping address via email [email protected] or fax 484.881.5997 referencing your VWR account number. Acceptable forms of ID are:
- • State issued document with your organization's Federal Tax ID Number
- • State issued document with your organization's Resale Tax ID Number
- • City or County issued Business License
- • State Department of Health Services License
- • Any other ID issued by the State that includes the business name & address
* ATTN: California Customers may require additional documentation as part of the CA Health & Safety Code. Products that fall under this regulation will be placed on a mandatory 21-day hold after documentation is received. Avantor will not lift restrictions for residential shipping addresses.
Specifications
- Application:
- Description:pUC/M13 Primer, Reverse (17mer), 2microg
- Size:2 μg
- Environmentally Preferable:
- Storage Conditions:-30°C to -10°C
- Cat. No.:PAQ5401
- Supplier no.:Q5401
Specifications
About this item
Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.
- Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
- Supplied at a concentration of 10microg/ml
The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.