Order Entry
Puerto Rico
ContactUsLinkComponent
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
Catalog # PAQ5601
CAS Number:  
undefined
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
Catalog # PAQ5601
Supplier Number:  Q5601
CAS Number:  

Some Products May Appear Restricted

To ensure a smooth and speedy checkout, please log in to your account. Some items may show as restricted simply because you're not logged in.

If you do not have an account, you can register using our registration webform (https://www.avantorsciences.com/us/en/login/register)

 

If you're still seeing restrictions after logging in, certain products—like chemicals or medical devices—require additional account verification steps to be able to place an order. Some items may additionally require a specific license or customer documentation;  additional documentation will be requested for these items prior to shipment. 

Specifications

  • Description:
    pUC/M13 Primer, Forward (24mer), 2microg
  • Size:
    2 μg
  • Storage Conditions:
    -30°C to -10°C
  • Cat. No.:
    PAQ5601
  • Supplier no.:
    Q5601

Specifications

About this item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10microg/ml

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.