Order Entry
Puerto Rico
ContactUsLinkComponent
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
Catalog # PAQ5601
CAS Number:  
undefined
pUC/M13 Primer, Forward (24 mer), 2 µg, Promega
Catalog # PAQ5601
Supplier Number:  Q5601
CAS Number:  
Restricted Products: To process your orders without delay, please provide the required business documentation to purchase this product.

To order chemicals, medical devices, or other restricted products please provide ID that includes your business name & shipping address via email [email protected] or fax 484.881.5997 referencing your VWR account number. Acceptable forms of ID are:

  • • State issued document with your organization's Federal Tax ID Number
  • • State issued document with your organization's Resale Tax ID Number
  • • City or County issued Business License
  • • State Department of Health Services License
  • • Any other ID issued by the State that includes the business name & address

* ATTN: California Customers may require additional documentation as part of the CA Health & Safety Code. Products that fall under this regulation will be placed on a mandatory 21-day hold after documentation is received. Avantor will not lift restrictions for residential shipping addresses.

Specifications

  • Description:
    pUC/M13 Primer, Forward (24mer), 2microg
  • Size:
    2 μg
  • Storage Conditions:
    -30°C to -10°C
  • Cat. No.:
    PAQ5601
  • Supplier no.:
    Q5601

Specifications

About this item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

  • Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
  • Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
  • Supplied at a concentration of 10microg/ml

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Forward (17mer)] 5'-d(GTTTTCCCAGTCACGAC)-3', [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Reverse (22mer)] 5'-d(TCACACAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.