Order Entry
China
ContactUsLinkComponent
PCR beads, Ready-To-Go™ You-Prime First-Strand Beads
PCR beads, Ready-To-Go™ You-Prime First-Strand Beads
Catalog # GEHE27-9264-01
Supplier:  GE HEALTHCARE
CAS Number:  
undefined
PCR beads, Ready-To-Go™ You-Prime First-Strand Beads
Catalog # GEHE27-9264-01
Supplier:  GE HEALTHCARE
CAS Number:  

Some Products May Appear Restricted

To ensure a smooth and speedy checkout, please log in to your account. Some items may show as restricted simply because you're not logged in.

If you do not have an account, you can register using our registration webform (https://www.avantorsciences.com/us/en/login/register)

 

If you're still seeing restrictions after logging in, certain products—like chemicals or medical devices—require additional account verification steps to be able to place an order. Some items may additionally require a specific license or customer documentation;  additional documentation will be requested for these items prior to shipment. 

Specifications

  • Pk:
    50 Tests
  • Description:
    Ready-To-Go™ You-Prime First-Strand beads, 55 reactions

Specifications

About this item

Ready-To-Go™ You-Prime First-Strand beads are preformulated, single-dose reaction beads prepackaged in thin-walled 0,5 ml tubes compatible with most thermal cyclers. Ready-To-Go™ You-Prime First-Strand beads are used for synthesis of first-strand cDNA templates from total RNA or polyadenylated RNA using a primer of choice.

  • Pre-dispensed, single-dose reaction beads minimise pipetting errors, avoid cross-contamination, and ensure optimal performance
  • First-strand reaction beads contain no primer, thus allowing users to select a first-strand primer of choice
  • Highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA from a variety of samples
  • Reaction beads are function tested for first-strand synthesis of cDNA up to 7,5 kb and in RT-PCR from blood samples

Completed reactions (33µL final volume) can be used in PCR after adding water, Taq DNA polymerase, and primers; first-strand cDNA can also be used as a template for traditional Gubler-Hoffman second-strand cDNA synthesis.

Ordering information: First-strand reaction mix (50 white tubes): Two beads containing reaction buffer, dATP, dCTP, dGTP,dTTP, Murine reverse transcriptase (FPLCpure), RNAguard™ (porcine), RNase/DNase-free BSA.
Control mix bead (5 red tubes): One ambient-temperature-stable bead containing rabbit globin mRNA (1 ng), buffer and 8 pmol each of 5’-specific globin primer (5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’) and 3’-specific globin primer (5’-d[GCCACTCACTCAGACTTTATTCAAA]-3’).